MTI-GlobalStem/The molecular biology of Oct-4 in the early mouse embryo./500 ng/abx232651-100ug

Preimplantation improvement within the mouse is characterised by the incidence of a number of important genetic and epigenetic occasions. Till just lately, little or no was recognized in regards to the regulation of those occasions. The seek for genes that are concerned within the management of the earliest phases of mouse improvement has to date resulted in just a few candidates. Oct-4, a member of the POU transcription issue household, is encoded by a gene belonging to this group.

Initially current as a maternal issue within the oocyte, Oct-Four is expressed by the embryo all through the preimplantation interval, in addition to in germ cell precursors of grownup mice. Oct-Four expression is correlated with an undifferentiated phenotype, each within the embryo and in cell traces derived from it.

Regulation of the Oct-Four gene depends on the exercise of two separate enhancers, certainly one of which is particularly energetic in pluri– and totipotent cells. Its operate as a transcriptional regulator is supported by the identification of an growing variety of potential goal genes, together with some recognized to be important for early embryonic improvement.

Early steps in microbial colonization processes at deep-sea hydrothermal vents.

A pluri-disciplinary in situ colonization experiment was carried out to review early phases of colonization in deep-sea vent Alvinella spp. worm habitats. 4 colonization units have been deployed onto Alvinella spp. colonies of various chimneys of the East-Pacific Rise (EPR 13 levels N), for 2 completely different intervals: a brief (lower than every week) and an extended one (three weeks).

Video imagery and monitoring of the thermal and physico-chemical situations have been carried out in the course of the colonization experiments. Quite a few microorganisms bearing specialised adhesion-appendages and/or excessive quantities of polymeric extracellular matrix have been noticed on units, which can effectively contribute to the colonization of recent surfaces. The microbial cohorts previous and accompanying Alvinella spp. settlement have been recognized.

EEF2 siRNA
20-abx914989	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EEF2 siRNA
20-abx901647	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EEF2 antibody
70R-2318	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal EEF2 antibody raised against the N terminal of EEF2

eEF2 antibody
70R-31022	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal eEF2 antibody

EEF2 antibody
70R-51523	Fitzgerald	100 ul	EUR 244.00
Description: Purified Polyclonal EEF2 antibody

EEF2 antibody
70R-17005	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal EEF2 antibody

EEF2 Antibody
ABD6798	Lifescience Market	100 ug	EUR 438.00

EEF2 Antibody
1-CSB-PA002260	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

EEF2 Antibody
1-CSB-PA007434GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EEF2 Antibody
1-CSB-PA007434LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

EEF2 Antibody
1-CSB-PA090786	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100

EEF2 Antibody
1-CSB-PA994433	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100

EEF2 Antibody
DF6798	Affbiotech	200ul	EUR 304.00
Description: EEF2 Antibody detects endogenous levels of total EEF2.

EEF2 antibody
10R-10728	Fitzgerald	100 ug	EUR 381.00
Description: Mouse monoclonal EEF2 antibody

EEF2 antibody
10R-11163	Fitzgerald	100 ug	EUR 349.00
Description: Mouse Monoclonal EEF2 antibody

EEF2 Antibody
32582-100ul	SAB	100ul	EUR 252.00

eEF2 Antibody
AF7720	Affbiotech	200ul	EUR 376.00
Description: eEF2 Antibody detects endogenous levels of eEF2.

eEF2 Antibody
AF7721	Affbiotech	200ul	EUR 376.00
Description: eEF2 Antibody detects endogenous levels of eEF2.

EEF2 Antibody
BF0405	Affbiotech	200ul	EUR 376.00
Description: EEF2 antibody detects endogenous levels of total EEF2.

EEF2 Polyclonal Antibody
E-AB-36536-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4. Purified by: Affinity purification Background: This gene encodes a member of the GTP-binding translation elongation factor family. This pro Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,ELISA applications.

EEF2 Polyclonal Antibody
E-AB-36536-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4. Purified by: Affinity purification Background: This gene encodes a member of the GTP-binding translation elongation factor family. This pro Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,ELISA applications.

EEF2 Polyclonal Antibody
E-AB-36536-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4. Purified by: Affinity purification Background: This gene encodes a member of the GTP-binding translation elongation factor family. This pro Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,ELISA applications.

EEF2 Polyclonal Antibody
E-AB-40218-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3. Purified by: Affinity purification Background: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an ess Show more
Description: Rabbit antibody against Human EEF2 for IHC applications.

EEF2 Polyclonal Antibody
E-AB-40218-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3. Purified by: Affinity purification Background: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an ess Show more
Description: Rabbit antibody against Human EEF2 for IHC applications.

EEF2 Polyclonal Antibody
E-AB-40218-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3. Purified by: Affinity purification Background: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an ess Show more
Description: Rabbit antibody against Human EEF2 for IHC applications.

EEF2 Rabbit pAb
A0099-100ul	Abclonal	100 ul	EUR 308.00

EEF2 Rabbit pAb
A0099-200ul	Abclonal	200 ul	EUR 459.00

EEF2 Rabbit pAb
A0099-20ul	Abclonal	20 ul	EUR 183.00

EEF2 Rabbit pAb
A0099-50ul	Abclonal	50 ul	EUR 223.00

EEF2 Polyclonal Antibody
A53432	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

EEF2 Rabbit pAb
A2068-100ul	Abclonal	100 ul	EUR 308.00

EEF2 Rabbit pAb
A2068-200ul	Abclonal	200 ul	EUR 459.00

EEF2 Rabbit pAb
A2068-20ul	Abclonal	20 ul	EUR 183.00

EEF2 Rabbit pAb
A2068-50ul	Abclonal	50 ul	EUR 223.00

eEF2 antibody (Thr56)
70R-31021	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal eEF2 antibody (Thr56)

EEF2 Blocking Peptide
DF6798-BP	Affbiotech	1mg	EUR 195.00

EEF2 Blocking Peptide
33R-9020	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF2 antibody, catalog no. 70R-2318

EEF2 Monoclonal Antibody
27102-100ul	SAB	100ul	EUR 252.00

EEF2 Monoclonal Antibody
27102-50ul	SAB	50ul	EUR 187.00

EEF2 Blocking Peptide
20-abx062098	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

eEF2 Polyclonal Antibody
ABP58457-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein Applications tips:
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein

eEF2 Polyclonal Antibody
ABP58457-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein Applications tips:
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein

eEF2 Polyclonal Antibody
ABP58457-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein Applications tips:
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein

EEF2 Polyclonal Antibody
E-AB-11179-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an es Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,IHC,ELISA applications.

EEF2 Polyclonal Antibody
E-AB-11179-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an es Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,IHC,ELISA applications.

EEF2 Polyclonal Antibody
E-AB-11179-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an es Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,IHC,ELISA applications.

EEF2 Polyclonal Antibody
E-AB-31275-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: This gene encodes a member of the GTP-binding translation elongation factor family. This pro Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,IHC-p,IF,ELISA applications.

EEF2 Polyclonal Antibody
E-AB-31275-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: This gene encodes a member of the GTP-binding translation elongation factor family. This pro Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,IHC-p,IF,ELISA applications.

EEF2 Polyclonal Antibody
E-AB-31275-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: This gene encodes a member of the GTP-binding translation elongation factor family. This pro Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,IHC-p,IF,ELISA applications.

EEF2 (pT56) Antibody
20-abx121387	Abbexa	EUR 314.00 EUR 467.00 EUR 203.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

eEF2 Blocking Peptide
AF7720-BP	Affbiotech	1mg	EUR 195.00

eEF2 Blocking Peptide
AF7721-BP	Affbiotech	1mg	EUR 195.00

EEF2 Blocking Peptide
BF0405-BP	Affbiotech	1mg	EUR 195.00

EEF2 Conjugated Antibody
C32582	SAB	100ul	EUR 397.00

EEF2 cloning plasmid
CSB-CL007434HU-10ug	Cusabio	10ug	EUR 558.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2577 Sequence: atggtgaacttcacggtagaccagatccgcgccatcatggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaagtccacgctgacagactccctggtgtgcaaggcgggcatcatcgcctcggcccgggccggggagacacgcttcactgata Show more
Description: A cloning plasmid for the EEF2 gene.

Anti-EEF2 antibody
PAab02651	Lifescience Market	100 ug	EUR 412.00

anti- EEF2 antibody
FNab02651	FN Test	100µg	EUR 585.00
Immunogen: eukaryotic translation elongation factor 2 Uniprot ID: P13639 Gene ID: 1938 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against EEF2

eEF2, Rabbit Reticulocytes
P1316-10	Biovision		EUR 370.00

anti-EEF2 (5B6)
LF-MA30553	Abfrontier	100 ul	EUR 527.00
Description: Mouse Monoclonal to EEF2

Anti-EEF2 antibody
STJ114864	St John"s Laboratory	100 µl	EUR 277.00
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation.

Anti-EEF2 antibody
STJ23480	St John"s Laboratory	100 µl	EUR 277.00
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation.

Anti-eEF2 antibody
STJ99117	St John"s Laboratory	200 µl	EUR 197.00
Description: Mouse monoclonal to eEF2.

Anti-eEF2 antibody
STJ99607	St John"s Laboratory	200 µl	EUR 197.00
Description: Rabbit polyclonal to eEF2.

Mouse EEF2 shRNA Plasmid
20-abx970115	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human EEF2 shRNA Plasmid
20-abx951337	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EEF2 protein (His tag)
80R-3897	Fitzgerald	100 ug	EUR 327.00
Description: Purified recombinant EEF2 protein (His tag)

Phospho- eEF2(Thr56)Antibody
ABF3572	Lifescience Market	100 ug	EUR 438.00

EEF2 recombinant monoclonal antibody
A5481	Bimake	100ul X 3	EUR 595.00
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human EEF2 for WB, IHC, IF,ELISA

EEF2 Antibody, HRP conjugated
1-CSB-PA007434LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EEF2 Antibody, FITC conjugated
1-CSB-PA007434LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EEF2 Antibody, Biotin conjugated
1-CSB-PA007434LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

eEF2(Phospho-Tyr443) Antibody
13078-100ul	SAB	100ul	EUR 252.00

eEF2(Phospho-Tyr443) Antibody
13078-50ul	SAB	50ul	EUR 187.00

eEF2(Phospho-Thr57) Antibody
13079-100ul	SAB	100ul	EUR 252.00

eEF2(Phospho-Thr57) Antibody
13079-50ul	SAB	50ul	EUR 187.00

Phospho-EEF2 (T56) Antibody
1-CSB-PA007904	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-EEF2 (T56). Recognizes Phospho-EEF2 (T56) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

EEF2 (pT56) Blocking Peptide
20-abx162401	Abbexa	EUR 314.00 EUR 509.00	1 mg 5 mg
Shipped within 5-10 working days.

Phospho-eEF2 (Tyr443) Antibody
AF7220	Affbiotech	200ul	EUR 376.00
Description: Phospho-eEF2 (Tyr443) Antibody detects endogenous levels of eEF2only when phosphorylated at Tyr443.

Phospho-eEF2 (Thr57) Antibody
AF7221	Affbiotech	200ul	EUR 376.00
Description: Phospho-eEF2 (Thr57) Antibody detects endogenous levels of eEF2only when phosphorylated at Thr57.

Rat EEF2 shRNA Plasmid
20-abx985590	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EEF2 Conjugated Monoclonal Antibody
C27102	SAB	100ul	EUR 397.00

Anti-EEF2 Monoclonal Antibody
M00830-1	BosterBio	100ug	EUR 397.00
Description: Rabbit Monoclonal EEF2 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

EEF2 ELISA KIT|Human
EF004938	Lifescience Market	96 Tests	EUR 689.00

pCMV-HA-EEF2 Plasmid
PVTB00283-2a	Lifescience Market	2 ug	EUR 356.00

EEF2 Polyclonal Antibody, Biotin Conjugated
A53429	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

EEF2 Polyclonal Antibody, FITC Conjugated
A53430	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

EEF2 Polyclonal Antibody, HRP Conjugated
A53431	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Mouse Elongation factor 2 (Eef2)
1-CSB-YP007434MO	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 97.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Elongation factor 2(Eef2) expressed in Yeast

eEF2 (Phospho-Thr56) Polyclonal Antibody
ABP58456-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein Applications tips:
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein

eEF2 (Phospho-Thr56) Polyclonal Antibody
ABP58456-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein Applications tips:
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein

eEF2 (Phospho-Thr56) Polyclonal Antibody
ABP58456-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein Applications tips:
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein

Human Elongation factor 2 (EEF2)
1-CSB-EP007434HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 99.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 2(EEF2) expressed in E.coli

Monoclonal EEF2 Antibody, Clone: 5B6
APR07656G	Leading Biology	0.1ml	EUR 528.00
Description: A Monoclonal antibody against Human EEF2. The antibodies are raised in Mouse and are from clone 5B6. This antibody is applicable in WB and IHC, ICC, E

Phospho-EEF2-T56 Rabbit pAb
AP0832-100ul	Abclonal	100 ul	EUR 384.00

Phospho-EEF2-T56 Rabbit pAb
AP0832-200ul	Abclonal	200 ul	EUR 554.00

Phospho-EEF2-T56 Rabbit pAb
AP0832-20ul	Abclonal	20 ul	EUR 183.00

Phospho-EEF2-T56 Rabbit pAb
AP0832-50ul	Abclonal	50 ul	EUR 265.00

Phospho-eEF2 (Tyr443) Blocking Peptide
AF7220-BP	Affbiotech	1mg	EUR 195.00

Phospho-eEF2 (Thr57) Blocking Peptide
AF7221-BP	Affbiotech	1mg	EUR 195.00

eEF2(Phospho-Tyr443) Conjugated Antibody
C13078	SAB	100ul	EUR 397.00

eEF2(Phospho-Thr57) Conjugated Antibody
C13079	SAB	100ul	EUR 397.00

EEF2 ORF Vector (Human) (pORF)
ORF012901	ABM	1.0 ug DNA	EUR 95.00

Eef2 ORF Vector (Rat) (pORF)
ORF066367	ABM	1.0 ug DNA	EUR 506.00

Eef2 ORF Vector (Mouse) (pORF)
ORF043640	ABM	1.0 ug DNA	EUR 506.00

Anti-Phospho-EEF2-T56 antibody
STJ11100973	St John"s Laboratory	100 µl	EUR 393.00
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation.

pCDNA3.1- EEF2- Myc- 6*His
PVT10365	Lifescience Market	2 ug	EUR 337.00

Anti-Phospho-eEF2 (Thr56) antibody
STJ99592	St John"s Laboratory	200 µl	EUR 197.00
Description: Rabbit polyclonal to Phospho-eEF2 (Thr56).

Anti-EEF2 Antibody (4B3-G7-H5)
A1314-100	Biovision		EUR 338.00

EEF2 sgRNA CRISPR Lentivector set (Human)
K0657801	ABM	3 x 1.0 ug	EUR 339.00

eEF2 Colorimetric Cell-Based ELISA Kit
EKC1180	BosterBio	100ul	EUR 572.00

Eef2 sgRNA CRISPR Lentivector set (Rat)
K6785201	ABM	3 x 1.0 ug	EUR 339.00

Eef2 sgRNA CRISPR Lentivector set (Mouse)
K3928501	ABM	3 x 1.0 ug	EUR 339.00

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody
20-abx214410	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody
20-abx214411	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody
20-abx270289	Abbexa	EUR 495.00 EUR 578.00 EUR 286.00 EUR 885.00 EUR 370.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody
20-abx329583	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Cow Elongation Factor 2 (EEF2) ELISA Kit
abx521279-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Chicken Elongation Factor 2 (EEF2) ELISA Kit
abx521280-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Human Elongation Factor 2 (EEF2) ELISA Kit
abx521281-96tests	Abbexa	96 tests	EUR 739.00
Shipped within 5-12 working days.

Rat Elongation Factor 2 (EEF2) ELISA Kit
abx521283-96tests	Abbexa	96 tests	EUR 739.00
Shipped within 5-12 working days.

Mouse Elongation Factor 2 (EEF2) ELISA Kit
abx255169-96tests	Abbexa	96 tests	EUR 739.00
Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Protein
20-abx261366	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Human elongation factor 2(eEF2) ELISA Kit
CSB-E13572h-24T	Cusabio	1 plate of 24 wells	EUR 165.00
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human elongation factor 2 (eEF2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human elongation factor 2(eEF2) ELISA Kit
1-CSB-E13572h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human elongation factor 2(eEF2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody
abx012012-100ul	Abbexa	100 ul	EUR 411.00
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody
20-abx001685	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody
20-abx007526	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody
20-abx130986	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody
abx159481-100ul	Abbexa	100 ul	EUR 467.00
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody
20-abx112354	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody
20-abx109749	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody
abx232651-100ug	Abbexa	100 ug	EUR 551.00
Shipped within 5-12 working days.

Rat Eef2/ Elongation factor 2 ELISA Kit
E0319Ra	Sunlong	1 Kit	EUR 646.00

EEF2 Protein Vector (Human) (pPB-C-His)
PV051601	ABM	500 ng	EUR 481.00

EEF2 Protein Vector (Human) (pPB-N-His)
PV051602	ABM	500 ng	EUR 481.00

EEF2 Protein Vector (Human) (pPM-C-HA)
PV051603	ABM	500 ng	EUR 481.00

EEF2 Protein Vector (Human) (pPM-C-His)
PV051604	ABM	500 ng	EUR 481.00

EEF2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0657802	ABM	1.0 ug DNA	EUR 154.00

EEF2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0657803	ABM	1.0 ug DNA	EUR 154.00

EEF2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0657804	ABM	1.0 ug DNA	EUR 154.00

Mouse Eef2(Elongation factor 2) ELISA Kit
EM0821	FN Test	96T	EUR 567.60
Detection range: 0.156-10 ng/ml Uniprot ID: P58252 Alias: Eef2/EF-2/EF2EEF-2/elongation factor 2/eukaryotic translation elongation factor 2/polypeptidyl-tRNA translocase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Human EEF2/ Elongation factor 2 ELISA Kit
E0763Hu	Sunlong	1 Kit	EUR 605.00

Mouse Eef2/ Elongation factor 2 ELISA Kit
E0450Mo	Sunlong	1 Kit	EUR 632.00

Chicken Elongation factor 2, EEF2 ELISA KIT
ELI-09302c	Lifescience Market	96 Tests	EUR 928.00

Human Elongation factor 2, EEF2 ELISA KIT
ELI-09303h	Lifescience Market	96 Tests	EUR 824.00

Rat Elongation factor 2, Eef2 ELISA KIT
ELI-32279r	Lifescience Market	96 Tests	EUR 886.00

Mouse Elongation factor 2, Eef2 ELISA KIT
ELI-32416m	Lifescience Market	96 Tests	EUR 865.00

Rabbit Elongation factor 2, EEF2 ELISA KIT
ELI-26044Ra	Lifescience Market	96 Tests	EUR 928.00

Bovine Elongation factor 2, EEF2 ELISA KIT
ELI-26079b	Lifescience Market	96 Tests	EUR 928.00

Eef2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6785202	ABM	1.0 ug DNA	EUR 154.00

Eef2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6785203	ABM	1.0 ug DNA	EUR 154.00

Eef2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6785204	ABM	1.0 ug DNA	EUR 154.00

Eef2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3928502	ABM	1.0 ug DNA	EUR 154.00

Eef2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3928503	ABM	1.0 ug DNA	EUR 154.00

Eef2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3928504	ABM	1.0 ug DNA	EUR 154.00

EEF2 Protein Vector (Mouse) (pPB-C-His)
PV174558	ABM	500 ng	EUR 1065.00

EEF2 Protein Vector (Mouse) (pPB-N-His)
PV174559	ABM	500 ng	EUR 1065.00

EEF2 Protein Vector (Mouse) (pPM-C-HA)
PV174560	ABM	500 ng	EUR 1065.00

EEF2 Protein Vector (Mouse) (pPM-C-His)
PV174561	ABM	500 ng	EUR 1065.00

EEF2 3"UTR Luciferase Stable Cell Line
TU006629	ABM	1.0 ml	EUR 1394.00

EEF2 3"UTR GFP Stable Cell Line
TU056629	ABM	1.0 ml	EUR 1394.00

EEF2 Protein Vector (Rat) (pPB-C-His)
PV265466	ABM	500 ng	EUR 1166.00

EEF2 Protein Vector (Rat) (pPB-N-His)
PV265467	ABM	500 ng	EUR 1166.00

EEF2 Protein Vector (Rat) (pPM-C-HA)
PV265468	ABM	500 ng	EUR 1166.00

EEF2 Protein Vector (Rat) (pPM-C-His)
PV265469	ABM	500 ng	EUR 1166.00

Recombinant Eukaryotic Translation Elongation Factor 2 (EEF2)
4-RPC453Hu01	Cloud-Clone	EUR 350.88 EUR 197.00 EUR 1040.80 EUR 413.60 EUR 727.20 EUR 298.00 EUR 2452.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P13639 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 25.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Eukaryotic Translation Elongation Factor 2 expressed in: E.coli

Eef2 3"UTR GFP Stable Cell Line
TU253793	ABM	1.0 ml	Ask for price

Eef2 3"UTR Luciferase Stable Cell Line
TU105615	ABM	1.0 ml	Ask for price

Eef2 3"UTR Luciferase Stable Cell Line
TU203793	ABM	1.0 ml	Ask for price

Eef2 3"UTR GFP Stable Cell Line
TU155615	ABM	1.0 ml	Ask for price

Eukaryotic Translation Elongation Factor 2 (EEF2) ELISA Kit
abx595189-96tests	Abbexa	96 tests	EUR 637.00
Shipped within 1-2 weeks.

Human Eukaryotic Translation Elongation Factor 2 (EEF2) Protein
20-abx168971	Abbexa	EUR 495.00 EUR 244.00 EUR 1414.00 EUR 578.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody (Biotin)
20-abx105373	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody (FITC)
20-abx106792	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody (HRP)
20-abx108211	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

eEF2 (Phospho-Thr56) Colorimetric Cell-Based ELISA Kit
EKC1985	BosterBio	100ul	EUR 572.00

EEF2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV671713	ABM	1.0 ug DNA	EUR 1355.00

EEF2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV671717	ABM	1.0 ug DNA	EUR 1355.00

EEF2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV671718	ABM	1.0 ug DNA	EUR 1355.00

EEF2 Eukaryotic Translation Elongation Factor 2 Human Recombinant Protein
PROTP13639	BosterBio	Regular: 20ug	EUR 317.00
Description: EEF2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 308 amino acids (574-858) and having a molecular mass of 34.3kDa.;EEF2 is fused to a 23 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human)
4-PAC453Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EEF2 (Lys32~Val233) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2)

Eef2ELISA Kit| Rat Elongation factor 2 ELISA Kit
EF018655	Lifescience Market	96 Tests	EUR 689.00

EEF2ELISA Kit| Bovine Elongation factor 2 ELISA Kit
EF011366	Lifescience Market	96 Tests	EUR 689.00

EEF2ELISA Kit| chicken Elongation factor 2 ELISA Kit
EF012297	Lifescience Market	96 Tests	EUR 689.00

Eef2 ELISA Kit| Mouse Elongation factor 2 ELISA Kit
EF013430	Lifescience Market	96 Tests	EUR 689.00

Eukaryotic Translation Elongation Factor 2 Phospho-Thr56 (EEF2 pT56) Antibody
20-abx329168	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human), APC
4-PAC453Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EEF2 (Lys32~Val233) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2). This antibody is labeled with APC.

Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human), Biotinylated
4-PAC453Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EEF2 (Lys32~Val233) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2). This antibody is labeled with Biotin.

Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human), Cy3
4-PAC453Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EEF2 (Lys32~Val233) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2). This antibody is labeled with Cy3.

In all instances, Archaea couldn’t be detected and the microbial mats have been basically composed of e-Proteobacteria. Inside this group, one phylotype (AlviH2) was discovered to dominate the libraries of three colonization units. Dominance of e-Proteobacteria within the libraries might replicate the vast physiological selection encountered inside this group or an adaptability of those microorganisms in the direction of their altering surroundings. Micro organism affiliated to the Cytophaga-Flavobacterium-Bacteroides group or to the e-Proteobacteria, that develop both chemo-organoheterotrophically by fermentation or chemolithoautotrophically with H2 as an electron donor and S levels /S2O32- or NO3- as a terminal electron acceptor, have been remoted from one of many microbial mat fashioned in 20 days.