产品资料

MTI-GlobalStem/Synapse formation and establishment of neuronal polarity by P19 embryonic carcinoma cells and embryonic stem cells./1mg/A54224

Various totally different cell strains that exhibit a partial neuronal phenotype have been recognized, however in lots of circumstances the complete extent of their neuronal differentiation has not been instantly addressed by useful research. We have now used electrophysiology and immunofluorescence to look at the formation of synapses and the event of neuronal polarity by murine embryonic stem (ES) cells and the mouse P19 embryonic carcinoma cell line.

Inside 2-Three weeks after induction by retinoic acid, subsets of P19 and ES cells shaped excitatory synapses, mediated by glutamate receptors, or inhibitory synapses, mediated by receptors for GABA or glycine. In ES-cell cultures, each NMDA and non-NMDA receptors contributed to the excitatory postsynaptic response.

EEF1D siRNA
20-abx914980	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EEF1D siRNA
20-abx914981	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EEF1D siRNA
20-abx901644	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EEF1D antibody
70R-17002	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal EEF1D antibody

EEF1D Antibody
ABD6974	Lifescience Market	100 ug	EUR 438.00

EEF1D Antibody
1-CSB-PA007431GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

EEF1D Antibody
1-CSB-PA007431LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

EEF1D Antibody
DF6974	Affbiotech	200ul	EUR 304.00
Description: EEF1D Antibody detects endogenous levels of total EEF1D.

EEF1D antibody
38412-100ul	SAB	100ul	EUR 252.00

anti-EEF1D
YF-PA11496	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to EEF1D

anti-EEF1D
YF-PA11497	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to EEF1D

anti-EEF1D
YF-PA23623	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to EEF1D

EEF1D Polyclonal Antibody
A54224	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

EEF1D Rabbit pAb
A2509-100ul	Abclonal	100 ul	EUR 308.00

EEF1D Rabbit pAb
A2509-200ul	Abclonal	200 ul	EUR 459.00

EEF1D Rabbit pAb
A2509-20ul	Abclonal	20 ul	EUR 183.00

EEF1D Rabbit pAb
A2509-50ul	Abclonal	50 ul	EUR 223.00

EEF1D Blocking Peptide
DF6974-BP	Affbiotech	1mg	EUR 195.00

Polyclonal EEF1D Antibody
AMM07014G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1D . This antibody is tested and proven to work in the following applications:

EEF1D Conjugated Antibody
C38412	SAB	100ul	EUR 397.00

EEF1D cloning plasmid
CSB-CL007431HU1-10ug	Cusabio	10ug	EUR 654.00
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 1944 Sequence: atgaggagcgggaaggcctcctgcaccctggagaccgtgtgggaagacaagcacaagtatgaggaggccgagcggcgcttctacgaacacgaggccacacaggcggccgcctccgcccagcagctgccagccgaggggccagccatgaatgggcccggccaggacgaccctgagg Show more
Description: A cloning plasmid for the EEF1D gene.

EEF1D cloning plasmid
CSB-CL007431HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 846 Sequence: atggctacaaacttcctagcacatgagaagatctggttcgacaagttcaaatatgacgacgcagaaaggagattctacgagcagatgaacgggcctgtggcaggtgcctcccgccaggagaacggcgccagcgtgatcctccgtgacattgcgagagccagagagaacatccagaa Show more
Description: A cloning plasmid for the EEF1D gene.

Anti-EEF1D antibody
PAab02646	Lifescience Market	100 ug	EUR 355.00

anti- EEF1D antibody
FNab02646	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Uniprot ID: P29692 Gene ID: 1936 Research Area: Signal Transduction, Metab Show more
Description: Antibody raised against EEF1D

anti- EEF1D antibody
FNab02647	FN Test	100µg	EUR 585.00
Recommended dilution: WB: 1:500-1:2000 IF: 1:10-1:100 IHC: 1:50-1:500 Immunogen: eukaryotic translation elongation factor 1 delta(guanine nucleotide exchange protein) Uniprot ID: P29692 Gene ID: 1936 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against EEF1D

anti- EEF1D antibody
FNab02648	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: eukaryotic translation elongation factor 1 delta(guanine nucleotide exchange protein) Uniprot ID: P29692 Gene ID: 1936 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against EEF1D

Anti-EEF1D antibody
STJ23477	St John"s Laboratory	100 µl	EUR 277.00
Description: This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit, delta, functions as guanine nucleotide exchange factor. It is reported that following HIV-1 infection, this subunit interacts with HIV-1 Tat. This interaction results in repression of translation of host cell proteins and enhanced translation of viral proteins. Several alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. Related pseudogenes have been defined on chromosomes 1, 6, 7, 9, 11, 13, 17, 19.

Anti-EEF1D(4B12)
YF-MA10264	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to EEF1D

Human EEF1D shRNA Plasmid
20-abx951335	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse EEF1D shRNA Plasmid
20-abx975725	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EEF1D protein (His tag)
80R-1713	Fitzgerald	50 ug	EUR 397.00
Description: Purified recombinant Human EEF1D protein

EEF1D Antibody, HRP conjugated
1-CSB-PA007431LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EEF1D Antibody, FITC conjugated
1-CSB-PA007431LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EEF1D Antibody, Biotin conjugated
1-CSB-PA007431LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat EEF1D shRNA Plasmid
20-abx989020	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EEF1D ELISA KIT\|Human
EF009298	Lifescience Market	96 Tests	EUR 689.00

EEF1D Recombinant Protein (Human)
RP010204	ABM	100 ug	Ask for price

EEF1D Recombinant Protein (Human)
RP010207	ABM	100 ug	Ask for price

EEF1D Recombinant Protein (Rat)
RP199088	ABM	100 ug	Ask for price

EEF1D Recombinant Protein (Mouse)
RP130904	ABM	100 ug	Ask for price

EEF1D Recombinant Protein (Mouse)
RP130907	ABM	100 ug	Ask for price

EEF1D Polyclonal Antibody, Biotin Conjugated
A54221	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

EEF1D Polyclonal Antibody, FITC Conjugated
A54222	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

EEF1D Polyclonal Antibody, HRP Conjugated
A54223	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Polyclonal EEF1D Antibody (N-term)
AMM07016G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1D (N-term). This antibody is tested and proven to work in the following applications:

EEF1D ORF Vector (Human) (pORF)
ORF003402	ABM	1.0 ug DNA	EUR 95.00

EEF1D ORF Vector (Human) (pORF)
ORF003403	ABM	1.0 ug DNA	EUR 95.00

Eef1d ORF Vector (Rat) (pORF)
ORF066364	ABM	1.0 ug DNA	EUR 506.00

Eef1d ORF Vector (Mouse) (pORF)
ORF043636	ABM	1.0 ug DNA	EUR 506.00

Eef1d ORF Vector (Mouse) (pORF)
ORF043637	ABM	1.0 ug DNA	EUR 506.00

Human Elongation factor 1-delta (EEF1D)
1-CSB-EP007431HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 35 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 1-delta(EEF1D) expressed in E.coli

EEF1D sgRNA CRISPR Lentivector set (Human)
K0657001	ABM	3 x 1.0 ug	EUR 339.00

Eef1d sgRNA CRISPR Lentivector set (Mouse)
K4608201	ABM	3 x 1.0 ug	EUR 339.00

Eef1d sgRNA CRISPR Lentivector set (Rat)
K7151201	ABM	3 x 1.0 ug	EUR 339.00

Monoclonal EEF1D Antibody (monoclonal) (M04), Clone: 4B12
AMM07015G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human EEF1D (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4B12. This antibody is applicable in WB and IF, E

EEF1D Protein Vector (Human) (pPB-C-His)
PV013605	ABM	500 ng	EUR 329.00

EEF1D Protein Vector (Human) (pPB-N-His)
PV013606	ABM	500 ng	EUR 329.00

EEF1D Protein Vector (Human) (pPM-C-HA)
PV013607	ABM	500 ng	EUR 329.00

EEF1D Protein Vector (Human) (pPM-C-His)
PV013608	ABM	500 ng	EUR 329.00

EEF1D Protein Vector (Human) (pPB-C-His)
PV013609	ABM	500 ng	EUR 329.00

EEF1D Protein Vector (Human) (pPB-N-His)
PV013610	ABM	500 ng	EUR 329.00

EEF1D Protein Vector (Human) (pPM-C-HA)
PV013611	ABM	500 ng	EUR 329.00

EEF1D Protein Vector (Human) (pPM-C-His)
PV013612	ABM	500 ng	EUR 329.00

EEF1D sgRNA CRISPR Lentivector (Human) (Target 1)
K0657002	ABM	1.0 ug DNA	EUR 154.00

EEF1D sgRNA CRISPR Lentivector (Human) (Target 2)
K0657003	ABM	1.0 ug DNA	EUR 154.00

EEF1D sgRNA CRISPR Lentivector (Human) (Target 3)
K0657004	ABM	1.0 ug DNA	EUR 154.00

Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4608202	ABM	1.0 ug DNA	EUR 154.00

Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4608203	ABM	1.0 ug DNA	EUR 154.00

Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4608204	ABM	1.0 ug DNA	EUR 154.00

Eef1d sgRNA CRISPR Lentivector (Rat) (Target 1)
K7151202	ABM	1.0 ug DNA	EUR 154.00

Eef1d sgRNA CRISPR Lentivector (Rat) (Target 2)
K7151203	ABM	1.0 ug DNA	EUR 154.00

Eef1d sgRNA CRISPR Lentivector (Rat) (Target 3)
K7151204	ABM	1.0 ug DNA	EUR 154.00

EEF1D Protein Vector (Mouse) (pPB-C-His)
PV174542	ABM	500 ng	EUR 603.00

EEF1D Protein Vector (Mouse) (pPB-N-His)
PV174543	ABM	500 ng	EUR 603.00

EEF1D Protein Vector (Mouse) (pPM-C-HA)
PV174544	ABM	500 ng	EUR 603.00

EEF1D Protein Vector (Mouse) (pPM-C-His)
PV174545	ABM	500 ng	EUR 603.00

EEF1D Protein Vector (Mouse) (pPB-C-His)
PV174546	ABM	500 ng	EUR 603.00

EEF1D Protein Vector (Mouse) (pPB-N-His)
PV174547	ABM	500 ng	EUR 603.00

EEF1D Protein Vector (Mouse) (pPM-C-HA)
PV174548	ABM	500 ng	EUR 603.00

EEF1D Protein Vector (Mouse) (pPM-C-His)
PV174549	ABM	500 ng	EUR 603.00

EEF1D 3"UTR Luciferase Stable Cell Line
TU006621	ABM	1.0 ml	EUR 1394.00

EEF1D 3"UTR GFP Stable Cell Line
TU056621	ABM	1.0 ml	EUR 1394.00

EEF1D Protein Vector (Rat) (pPB-C-His)
PV265454	ABM	500 ng	EUR 603.00

EEF1D Protein Vector (Rat) (pPB-N-His)
PV265455	ABM	500 ng	EUR 603.00

EEF1D Protein Vector (Rat) (pPM-C-HA)
PV265456	ABM	500 ng	EUR 603.00

EEF1D Protein Vector (Rat) (pPM-C-His)
PV265457	ABM	500 ng	EUR 603.00

Eef1d 3"UTR GFP Stable Cell Line
TU253790	ABM	1.0 ml	Ask for price

Eef1d 3"UTR Luciferase Stable Cell Line
TU105612	ABM	1.0 ml	Ask for price

Eef1d 3"UTR Luciferase Stable Cell Line
TU203790	ABM	1.0 ml	Ask for price

Eef1d 3"UTR GFP Stable Cell Line
TU155612	ABM	1.0 ml	Ask for price

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody
abx032848-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody
abx032848-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody
20-abx001951	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) Antibody
20-abx176323	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) Antibody
20-abx176324	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody
20-abx112351	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody
20-abx109748	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody
abx122804-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody
20-abx225153	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody
abx232646-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody
abx232647-100ug	Abbexa	100 ug	EUR 551.00
Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody
abx232648-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Human Elongation Factor 1 Delta (EEF1D) ELISA Kit
abx387054-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Bovine Elongation factor 1- delta, EEF1D ELISA KIT
ELI-09301b	Lifescience Market	96 Tests	EUR 928.00

Mouse Elongation factor 1- delta, Eef1d ELISA KIT
ELI-10015m	Lifescience Market	96 Tests	EUR 865.00

Rabbit Elongation factor 1- delta, EEF1D ELISA KIT
ELI-47136Ra	Lifescience Market	96 Tests	EUR 928.00

Human Elongation factor 1- delta, EEF1D ELISA KIT
ELI-47510h	Lifescience Market	96 Tests	EUR 824.00

EEF1D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV679495	ABM	1.0 ug DNA	EUR 682.00

EEF1D Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV679499	ABM	1.0 ug DNA	EUR 682.00

EEF1D Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV679500	ABM	1.0 ug DNA	EUR 682.00

EEF1D Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV709593	ABM	1.0 ug DNA	EUR 316.00

EEF1D Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV709597	ABM	1.0 ug DNA	EUR 316.00

EEF1D Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV709598	ABM	1.0 ug DNA	EUR 316.00

Recombinant Eukaryotic Translation Elongation Factor 1 Delta (EEF1d)
4-RPF024Hu01	Cloud-Clone	EUR 386.72 EUR 206.00 EUR 1175.20 EUR 458.40 EUR 816.80 EUR 322.00 EUR 2788.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P29692 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Eukaryotic Translation Elongation Factor 1 Delta expressed in: E.coli

Recombinant Eukaryotic Translation Elongation Factor 1 Delta (EEF1d)
4-RPF024Mu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P57776 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Eukaryotic Translation Elongation Factor 1 Delta expressed in: E.coli

Human Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) Protein
20-abx650635	Abbexa	EUR 551.00 EUR 244.00 EUR 1595.00 EUR 648.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) Protein
20-abx650636	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody (Biotin)
20-abx105372	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody (FITC)
20-abx106791	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody (HRP)
20-abx108210	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

EEF1D Eukaryotic Translation Elongation Factor 1 Delta Human Recombinant Protein
PROTP29692	BosterBio	Regular: 10ug	EUR 317.00
Description: EEF1D Human Recombinant fused with a20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing301 amino acids (1-281 a.a.) and having a molecular mass of 33.2kDa (Molecular weight on SDS-PAGE will appear higher). The EEF1D is purified by proprietary chromatographic techniques.

EEF1D sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0657005	ABM	3 x 1.0 ug	EUR 376.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4608205	ABM	3 x 1.0 ug	EUR 376.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7151205	ABM	3 x 1.0 ug	EUR 376.00

EEF1D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0657006	ABM	1.0 ug DNA	EUR 167.00

EEF1D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0657007	ABM	1.0 ug DNA	EUR 167.00

EEF1D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0657008	ABM	1.0 ug DNA	EUR 167.00

EEF1D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV679496	ABM	1.0 ug DNA	EUR 682.00

EEF1D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV679497	ABM	1.0 ug DNA	EUR 740.00

EEF1D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV679498	ABM	1.0 ug DNA	EUR 740.00

EEF1D Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV709594	ABM	1.0 ug DNA	EUR 316.00

EEF1D Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV709595	ABM	1.0 ug DNA	EUR 374.00

EEF1D Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV709596	ABM	1.0 ug DNA	EUR 374.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4608206	ABM	1.0 ug DNA	EUR 167.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4608207	ABM	1.0 ug DNA	EUR 167.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4608208	ABM	1.0 ug DNA	EUR 167.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7151206	ABM	1.0 ug DNA	EUR 167.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7151207	ABM	1.0 ug DNA	EUR 167.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7151208	ABM	1.0 ug DNA	EUR 167.00

Staining with antibodies to growth-associated protein-43 and microtubule-associated protein-2 revealed segregation of immunoreactivity into separate axonal and somato-dendritic compartments, respectively. In keeping with our physiological proof for synapse formation, intense punctate staining was noticed with antibodies to the synaptic vesicle proteins synapsin, SV2, and synaptophysin. These outcomes exhibit the in vitro acquisition by pluri-potent cell strains of neuronal polarity and useful synaptic transmission that’s attribute of CNS neurons.

对照品标准品，生物试剂盒，gibco胎牛血清，试剂采购网，中国试剂网，细胞因子试剂盒

MTI-GlobalStem/Synapse formation and establishment of neuronal polarity by P19 embryonic carcinoma cells and embryonic stem cells./1mg/A54224

EEF1D siRNA

EEF1D siRNA

EEF1D siRNA

EEF1D antibody

EEF1D Antibody

EEF1D Antibody

EEF1D Antibody

EEF1D Antibody

EEF1D antibody

anti-EEF1D

anti-EEF1D

anti-EEF1D

EEF1D Polyclonal Antibody

EEF1D Rabbit pAb

EEF1D Rabbit pAb

EEF1D Rabbit pAb

EEF1D Rabbit pAb

EEF1D Blocking Peptide

Polyclonal EEF1D Antibody

EEF1D Conjugated Antibody

EEF1D cloning plasmid

EEF1D cloning plasmid

Anti-EEF1D antibody

anti- EEF1D antibody

anti- EEF1D antibody

anti- EEF1D antibody

Anti-EEF1D antibody

Anti-EEF1D(4B12)

Human EEF1D shRNA Plasmid

Mouse EEF1D shRNA Plasmid

EEF1D protein (His tag)

EEF1D Antibody, HRP conjugated

EEF1D Antibody, FITC conjugated

EEF1D Antibody, Biotin conjugated

Rat EEF1D shRNA Plasmid

EEF1D ELISA KIT|Human

EEF1D Recombinant Protein (Human)

EEF1D Recombinant Protein (Human)

EEF1D Recombinant Protein (Rat)

EEF1D Recombinant Protein (Mouse)

EEF1D Recombinant Protein (Mouse)

EEF1D Polyclonal Antibody, Biotin Conjugated

EEF1D Polyclonal Antibody, FITC Conjugated

EEF1D Polyclonal Antibody, HRP Conjugated

Polyclonal EEF1D Antibody (N-term)

EEF1D ORF Vector (Human) (pORF)

EEF1D ORF Vector (Human) (pORF)

Eef1d ORF Vector (Rat) (pORF)

Eef1d ORF Vector (Mouse) (pORF)

Eef1d ORF Vector (Mouse) (pORF)

Human Elongation factor 1-delta (EEF1D)

EEF1D sgRNA CRISPR Lentivector set (Human)

Eef1d sgRNA CRISPR Lentivector set (Mouse)

Eef1d sgRNA CRISPR Lentivector set (Rat)

Monoclonal EEF1D Antibody (monoclonal) (M04), Clone: 4B12

EEF1D Protein Vector (Human) (pPB-C-His)

EEF1D Protein Vector (Human) (pPB-N-His)

EEF1D Protein Vector (Human) (pPM-C-HA)

EEF1D Protein Vector (Human) (pPM-C-His)

EEF1D Protein Vector (Human) (pPB-C-His)

EEF1D Protein Vector (Human) (pPB-N-His)

EEF1D Protein Vector (Human) (pPM-C-HA)

EEF1D Protein Vector (Human) (pPM-C-His)

EEF1D sgRNA CRISPR Lentivector (Human) (Target 1)

EEF1D sgRNA CRISPR Lentivector (Human) (Target 2)

EEF1D sgRNA CRISPR Lentivector (Human) (Target 3)

Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 1)

Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 2)

Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 3)

Eef1d sgRNA CRISPR Lentivector (Rat) (Target 1)

Eef1d sgRNA CRISPR Lentivector (Rat) (Target 2)

Eef1d sgRNA CRISPR Lentivector (Rat) (Target 3)

EEF1D Protein Vector (Mouse) (pPB-C-His)

EEF1D Protein Vector (Mouse) (pPB-N-His)

EEF1D Protein Vector (Mouse) (pPM-C-HA)

EEF1D Protein Vector (Mouse) (pPM-C-His)

EEF1D Protein Vector (Mouse) (pPB-C-His)

EEF1D Protein Vector (Mouse) (pPB-N-His)